Detail of EST/Unigene CX520609 |
Acc. | CX520609 |
Internal Acc. | s13dNF57G08VI066_449004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=6e-53; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-43; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=3e-21; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=3e-16; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=1e-15; |
Length | 373 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTTTATTTTTTCTTTGTCACTGCCACCGCTACTACTACCTCTAGTAGTTGAACATGGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823901 |
Trichome-related Gene from Literature | N/A |