| Detail of EST/Unigene CX520943 |
| Acc. | CX520943 |
| Internal Acc. | s13dNF59G09VI070_449672 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=9e-97; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=3e-89; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=4e-89; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=6e-88; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=1e-86; |
| Length | 556 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CCCACTTGCATTCCAAAACACCAAACTCATGACACGTTTAACCTACACCCTCGACGAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824246 |
| Trichome-related Gene from Literature | N/A |