| Detail of EST/Unigene CX521063 |
| Acc. | CX521063 |
| Internal Acc. | s13dNF65C04VI022_449912 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-65; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-50; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=4e-49; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=3e-48; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=1e-47; |
| Length | 497 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ATAAACTATACTAGACTCTAGCAAAATGGCCTCTACACAATGCTTCTTGCACCCCCAATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |