Detail of EST/Unigene CX521069 |
Acc. | CX521069 |
Internal Acc. | s13dNF65C10VI072_449924 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=1e-82; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-81; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-81; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=4e-80; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=2e-79; |
Length | 574 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CCGTGAGCTTGAAGTAATTCACAGCAGATGGGCCATGCTTGGTGCATTGGGATGTACCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |