Detail of EST/Unigene CX521085 |
Acc. | CX521085 |
Internal Acc. | s13dNF65E04VI024_449956 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=8e-76; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=8e-76; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=2e-75; GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=6e-73; UDP-glucuronic acid decarboxylase 1 OS=Danio rerio E-value=1e-09; |
Length | 544 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CACAGACAAATTTGAGATGTGGGGAGATGGTTTGCAAACACGATCATTCACCTTCATCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K08678 UDP-glucuronate decarboxylase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K08678 UDP-glucuronate decarboxylase |
EC | 4.1.1.35 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833002 |
Trichome-related Gene from Literature | N/A |