| Detail of EST/Unigene CX521207 |
| Acc. | CX521207 |
| Internal Acc. | s13dNF69B07VI059_450200 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=9e-88; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=4e-85; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=1e-84; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=1e-84; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=3e-83; |
| Length | 546 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTTTCTTCTTTCGCGCCTTTTGCTTGAGGACCTGGGCAAATCTGACTACCCTTCAAAGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828853 |
| Trichome-related Gene from Literature | N/A |