Detail of EST/Unigene CX521243 |
Acc. | CX521243 |
Internal Acc. | s13dNF69F04VI032_450272 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphatase IMPL1, chloroplastic OS=Arabidopsis thaliana E-value=6e-45; Inositol-1-monophosphatase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-15; Inositol monophosphatase 3 OS=Solanum lycopersicum E-value=8e-14; Inositol-1-monophosphatase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=1e-13; Inositol monophosphatase 1 OS=Solanum lycopersicum E-value=1e-13; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCGATCATAATGATGTCAATTGTTTTCTCCACCTCCGCGGCAGCTACAAAACTATTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
EC | 3.1.3.25 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840007 |
Trichome-related Gene from Literature | N/A |