Detail of EST/Unigene CX521253 |
Acc. | CX521253 |
Internal Acc. | s13dNF69G03VI020_450292 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=4e-62; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=6e-62; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-62; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-62; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=7e-62; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CATCCTACCTCACCGGTGAATTTCCTGGTGACTACGGTTGGGACACTGCTGGACTTTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |