Detail of EST/Unigene CX521319 |
Acc. | CX521319 |
Internal Acc. | s13dNF81E07VI053_450424 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-84; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=2e-72; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=8e-71; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=5e-69; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=8e-69; |
Length | 562 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ACCATATTGTTTGCAAGGCACAGAAACAAGATGTTGAGGATGTTGCTGTCAGTGTTGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |