Detail of EST/Unigene CX521378 |
Acc. | CX521378 |
Internal Acc. | s13dNF75C11VI084_450542 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=6e-57; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-49; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=1e-48; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=9e-31; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=3e-10; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCCAGCCACCATGGCAACCACCGCAACCGCCGCCACCATGTCACATTTTTTCGGCACAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818599 |
Trichome-related Gene from Literature | N/A |