Detail of EST/Unigene CX521479 |
Acc. | CX521479 |
Internal Acc. | s13dNF76E10VI081_450744 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=2e-48; Mitogen-activated protein kinase kinase 1 OS=Arabidopsis thaliana E-value=6e-45; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=9e-38; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=2e-37; Dual specificity mitogen-activated protein kinase kinase 1 OS=Dictyostelium discoideum E-value=5e-12; |
Length | 562 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ACCCTACACCCTATAATCTTCTGATAATCATAATCATAATCATGAAGAAAGGAAATTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04369 mitogen-activated protein kinase kinase 2 |
EC | 2.7.12.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829103 |
Trichome-related Gene from Literature | N/A |