Detail of EST/Unigene CX521677 |
Acc. | CX521677 |
Internal Acc. | s13dNF1KH07VI064_469158 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-19; PsbP domain-containing protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; PsbP domain-containing protein 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-06; |
Length | 615 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | AACAATGGCATCCCTTCAGACTTCACCTACACTTCACAGAACTCTCTTTCAAAACTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824699 |
Trichome-related Gene from Literature | N/A |