| Detail of EST/Unigene CX521677 |
| Acc. | CX521677 |
| Internal Acc. | s13dNF1KH07VI064_469158 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-19; PsbP domain-containing protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; PsbP domain-containing protein 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-06; |
| Length | 615 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | AACAATGGCATCCCTTCAGACTTCACCTACACTTCACAGAACTCTCTTTCAAAACTCTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824699 |
| Trichome-related Gene from Literature | N/A |