Detail of EST/Unigene CX521718 |
Acc. | CX521718 |
Internal Acc. | s13dNF1SD11VI094_469240 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=9e-20; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-19; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-19; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-19; |
Length | 556 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATTGTCTTTAACTTACCTTGGTCTCTTTCTAAGCCGGATATCAAGGATCTCTTCGGTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818107 |
Trichome-related Gene from Literature | N/A |