| Detail of EST/Unigene CX521981 |
| Acc. | CX521981 |
| Internal Acc. | s13dNF1IF02VI015_469766 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; |
| Length | 92 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CCGGAGCAAAGTCACCGGAGTGGCTAGACGGAAGTTTGGTCGGAGATTACGGATTTGATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820043 |
| Trichome-related Gene from Literature | N/A |