Detail of EST/Unigene CX522029 |
Acc. | CX522029 |
Internal Acc. | s13dNF68C02VI006_469862 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-81; Phytoene synthase, chloroplastic OS=Cucumis melo E-value=3e-80; Phytoene synthase, chloroplastic OS=Narcissus pseudonarcissus E-value=3e-80; Phytoene synthase, chloroplastic OS=Capsicum annuum E-value=2e-79; Phytoene synthase 2, chloroplastic (Fragment) OS=Solanum lycopersicum E-value=2e-79; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCTTGATGCTGCTTTATCAGATACCGTCAACAGATTTCCTGTCGATATCCAGCCATTTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831587 |
Trichome-related Gene from Literature | N/A |