| Detail of EST/Unigene CX522029 |
| Acc. | CX522029 |
| Internal Acc. | s13dNF68C02VI006_469862 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phytoene synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-81; Phytoene synthase, chloroplastic OS=Cucumis melo E-value=3e-80; Phytoene synthase, chloroplastic OS=Narcissus pseudonarcissus E-value=3e-80; Phytoene synthase, chloroplastic OS=Capsicum annuum E-value=2e-79; Phytoene synthase 2, chloroplastic (Fragment) OS=Solanum lycopersicum E-value=2e-79; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GCTTGATGCTGCTTTATCAGATACCGTCAACAGATTTCCTGTCGATATCCAGCCATTTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.5.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831587 |
| Trichome-related Gene from Literature | N/A |