| Detail of EST/Unigene CX522193 |
| Acc. | CX522193 |
| Internal Acc. | s13dNF79D06VI048_470190 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit N, chloroplastic OS=Arabidopsis thaliana E-value=1e-50; Photosystem I reaction center subunit N, chloroplastic OS=Hordeum vulgare E-value=2e-40; Photosystem I reaction center subunit N, chloroplastic (Fragment) OS=Zea mays E-value=5e-40; Photosystem I reaction center subunit N, chloroplastic OS=Volvox carteri E-value=2e-22; |
| Length | 585 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CACAGATCGATCAGCAGAACTAAACTAGCAATCCATTACACATGGCTGCAATGAACTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836525 |
| Trichome-related Gene from Literature | N/A |