Detail of EST/Unigene CX522269 |
Acc. | CX522269 |
Internal Acc. | s13dNF67D04VI030_470342 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=3e-55; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=2e-08; Quinone oxidoreductase-like protein 2 homolog OS=Nematostella vectensis E-value=5e-08; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=5e-08; |
Length | 465 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GTAAAGGACTTCAAAGTTGGTGATGAAGTGTATGGTGATGTAAATGAGAAAGCATTAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838984 |
Trichome-related Gene from Literature | N/A |