| Detail of EST/Unigene CX522304 |
| Acc. | CX522304 |
| Internal Acc. | s13dNF78A01VI001_470412 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Violaxanthin de-epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; Violaxanthin de-epoxidase, chloroplastic OS=Lactuca sativa E-value=6e-33; Violaxanthin de-epoxidase, chloroplastic OS=Spinacia oleracea E-value=6e-33; Violaxanthin de-epoxidase, chloroplastic OS=Nicotiana tabacum E-value=2e-32; |
| Length | 461 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GTTTTACCTGAATCTATTATTCCTGAACTTGATAGAGCGGCAAAGAGTGTAGGAAGAGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837377 |
| Trichome-related Gene from Literature | N/A |