Detail of EST/Unigene CX522320 |
Acc. | CX522320 |
Internal Acc. | s13dNF78B06VI046_470444 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=3e-52; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=2e-48; Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=6e-45; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=6e-40; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=3e-39; |
Length | 457 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATAATTTGCCAGATGGGTTCTTAGAGGGAATAAGTGAGAGAGGAAAAGTGGTGAACTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827220 |
Trichome-related Gene from Literature | 827220 |