Detail of EST/Unigene CX522332 |
Acc. | CX522332 |
Internal Acc. | s13dNF78C08VI056_470468 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=4e-53; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=5e-41; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=6e-39; Plastocyanin, chloroplastic OS=Silene pratensis E-value=6e-39; Plastocyanin major isoform, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; |
Length | 474 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GAAGAGACTAATTAATCATCTTGAGAGAAAATGGCCACCGTTACTTCCACCACCGTTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838622 |
Trichome-related Gene from Literature | N/A |