Detail of EST/Unigene CX522369 |
Acc. | CX522369 |
Internal Acc. | s13dNF78H07VI062_470542 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=5e-50; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=1e-45; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=2e-42; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=9e-23; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=9e-15; |
Length | 475 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CAAAAGTCAACACATTCACACCAAGCAAAAAGAGATTTTCAAGTCTTGTTGTCAAAGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842016 |
Trichome-related Gene from Literature | N/A |