| Detail of EST/Unigene CX522458 |
| Acc. | CX522458 |
| Internal Acc. | s13dNF86B03VI025_470720 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Medicago sativa E-value=4e-90; Caffeoyl-CoA O-methyltransferase OS=Populus tremuloides E-value=9e-80; Caffeoyl-CoA O-methyltransferase 1 OS=Populus trichocarpa E-value=1e-79; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=8e-79; Caffeoyl-CoA O-methyltransferase 2 OS=Populus trichocarpa E-value=1e-78; |
| Length | 543 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CACATAGCAGAAACAGAAAAAGAAGCAAAACATTCCAAGAATTTAACAATGGCAACCAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
| EC | 2.1.1.104 2.1.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829551 |
| Trichome-related Gene from Literature | N/A |