Detail of EST/Unigene CX522647 |
Acc. | CX522647 |
Internal Acc. | s13dNF89E07VI055_471098 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=2e-92; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=5e-91; Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=6e-78; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=2e-48; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=9e-26; |
Length | 532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCAGAATATTTGCAATTTGATCTCGACTCGCTTGATCAGAATTTGGCAAAGAATCTTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830325 |
Trichome-related Gene from Literature | N/A |