| Detail of EST/Unigene CX522651 |
| Acc. | CX522651 |
| Internal Acc. | s13dNF89E11VI087_471106 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=3e-58; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=4e-54; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=7e-53; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=2e-52; |
| Length | 599 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | TAGGAGTTTGCTATGGAGTGCTTGGCAATAATCTACCATCAAGTCAAGAAGTTGTGGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |