| Detail of EST/Unigene CX522689 |
| Acc. | CX522689 |
| Internal Acc. | s13dNF90A07VI053_471182 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=6e-88; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-46; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=3e-46; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=4e-46; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=7e-46; |
| Length | 558 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GAGAAGTCCCTGGAGACTACGGTTATGATCCTTTTGGTCTAAGCAAGAAGCCCGAAGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826626 |
| Trichome-related Gene from Literature | N/A |