Detail of EST/Unigene CX522830 |
Acc. | CX522830 |
Internal Acc. | s13dNF85E12VI099_471464 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=9e-82; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=9e-82; Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=8e-59; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=4e-41; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=4e-31; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | AGAGAATGTGAGTTGATTCATGGTAGGTGGGCTATGCTTGCTACTCTTGGTGCTCTTACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830325 |
Trichome-related Gene from Literature | N/A |