| Detail of EST/Unigene CX522956 |
| Acc. | CX522956 |
| Internal Acc. | s13dNF87A02VI017_471716 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-33; Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-32; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-30; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-15; Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; |
| Length | 461 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTTTTCATAGCATAGCATTTACACCTTCATTCATTCTCTTTTGTGTAAGTGTAAATGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829088 |
| Trichome-related Gene from Literature | N/A |