Detail of EST/Unigene CX522956 |
Acc. | CX522956 |
Internal Acc. | s13dNF87A02VI017_471716 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-33; Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-32; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-30; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-15; Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; |
Length | 461 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTTTTCATAGCATAGCATTTACACCTTCATTCATTCTCTTTTGTGTAAGTGTAAATGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829088 |
Trichome-related Gene from Literature | N/A |