| Detail of EST/Unigene CX523057 |
| Acc. | CX523057 |
| Internal Acc. | s13dNF88B12VI101_471918 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=3e-11; Chlorophyll a-b binding protein 5, chloroplastic (Fragment) OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=1e-10; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-10; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-10; |
| Length | 140 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ACTATTTGGGCAACCCAAACCTGATCCATGCTCAGAGCATTCTTGCAATCTGGGCTACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815055 |
| Trichome-related Gene from Literature | N/A |