Detail of EST/Unigene CX523143 |
Acc. | CX523143 |
Internal Acc. | s13dNF80B12VI101_472090 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=1e-34; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=7e-32; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-31; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-31; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-24; |
Length | 472 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GGTTTAAGAGCCTATGTTGGTAACTTGCCATGGGACGTTGACAATTCTAGCTTGGAGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828579 |
Trichome-related Gene from Literature | N/A |