Detail of EST/Unigene CX523222 |
Acc. | CX523222 |
Internal Acc. | s13dNF1GB01VI013_472248 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 3, chloroplastic OS=Spinacia oleracea E-value=2e-41; 30S ribosomal protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-38; 30S ribosomal protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=9e-37; 30S ribosomal protein 3, chloroplastic OS=Hordeum vulgare E-value=2e-34; Probable 30S ribosomal protein 3, chloroplastic OS=Mesostigma viride E-value=3e-21; |
Length | 476 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCGAATCCAACAACAATGAACATGTTAGCATCATCATCATCAACAACATCATCAATGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843189 |
Trichome-related Gene from Literature | N/A |