| Detail of EST/Unigene CX523261 |
| Acc. | CX523261 |
| Internal Acc. | s13dNF1GE07VI055_472326 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=8e-51; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=2e-45; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=4e-44; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-43; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=3e-42; |
| Length | 363 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | TATCATTCCCATCTGGTGTTGCCTACAGAAAATCTCGTTTTATTTGCAATGCTCGTGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820775 |
| Trichome-related Gene from Literature | N/A |