Detail of EST/Unigene CX523285 |
Acc. | CX523285 |
Internal Acc. | s13dNF1GG08VI068_472374 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Pisum sativum E-value=2e-67; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Arabidopsis thaliana E-value=2e-66; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment) OS=Sinapis alba E-value=4e-66; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Spinacia oleracea E-value=2e-64; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Zea mays E-value=5e-63; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CAAGGTCCTTGATCAGAAATTCGGTATCATCAAGGGTACCATGACTACCACTCACTCCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822277 |
Trichome-related Gene from Literature | N/A |