Detail of EST/Unigene CX523476 |
Acc. | CX523476 |
Internal Acc. | s13dNF84A06VI049_474672 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=4e-76; Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=6e-76; Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=3e-72; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-72; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. indica E-value=4e-72; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GAAATTTATGAGTGAAATTAGGGCGTCGCTCACCTATGAATTACCACTAGCTGAGATGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |