Detail of EST/Unigene CX523491 |
Acc. | CX523491 |
Internal Acc. | s13dNF84B09VI077_474702 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RING-box protein 1a OS=Arabidopsis thaliana E-value=1e-60; RING-box protein 1b OS=Arabidopsis thaliana E-value=4e-53; RING-box protein 1 OS=Salmo salar E-value=2e-51; E3 ubiquitin-protein ligase RBX1 OS=Mus musculus E-value=2e-51; E3 ubiquitin-protein ligase RBX1 OS=Homo sapiens E-value=2e-51; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CAGCGATTCAGTGAAAAGAAAAAACTGAGAAGAGAAGAGAAATGGCGACACTTGATTCCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03868 RING-box protein 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03868 RING-box protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832179 |
Trichome-related Gene from Literature | N/A |