Detail of EST/Unigene CX523532 |
Acc. | CX523532 |
Internal Acc. | s13dNF84F02VI027_474784 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=1e-53; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-36; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=4e-36; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=6e-36; |
Length | 487 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCAGTGTTAATTTGCCTTAGAAACCAAAAAAGTAGAAGAAGAAGAAGAAGAAATAATAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |