Detail of EST/Unigene CX523545 |
Acc. | CX523545 |
Internal Acc. | s13dNF84G03VI024_474810 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=9e-26; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Triticum aestivum E-value=9e-25; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=9e-25; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=9e-25; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=9e-25; |
Length | 183 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | AACTGACAGAAAGTCCGGTGGTCTCGGCGACTTGAACTATCCTTTGGTTTCTGATGTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830517 |
Trichome-related Gene from Literature | N/A |