| Detail of EST/Unigene CX523592 |
| Acc. | CX523592 |
| Internal Acc. | s13dNF1ZD01VI014_479896 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=6e-58; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=5e-57; Transketolase, chloroplastic OS=Zea mays E-value=1e-54; Transketolase, chloroplastic OS=Solanum tuberosum E-value=9e-54; Transketolase 7 OS=Craterostigma plantagineum E-value=1e-47; |
| Length | 485 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ATTGAAGGTGTTGAAAAGGGTGGCTACACCATTTCAGACAACTCATCAGGTAACAAGCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |