Detail of EST/Unigene CX523605 |
Acc. | CX523605 |
Internal Acc. | s13dNF1ZE10VI083_479922 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=1e-71; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=8e-67; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=3e-66; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-51; Fructose-1,6-bisphosphatase class 1 OS=Geobacter uraniireducens (strain Rf4) E-value=8e-17; |
Length | 433 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ACCACTTATGTACTTGCACTTAAGGACTTCCCCGGCACTCATGAATTTCTACTTCTTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
EC | 3.1.3.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824746 |
Trichome-related Gene from Literature | N/A |