Detail of EST/Unigene CX523740 |
Acc. | CX523740 |
Internal Acc. | s13dNF01E01AT007_336327 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=5e-55; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=1e-27; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-27; Carbonic anhydrase OS=Flaveria brownii E-value=2e-24; |
Length | 511 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TGAGTCTTCATTGTCACAATGTCTACCTCTTCCATAAACGGCTTTAGTCTCTCTTCTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |