| Detail of EST/Unigene CX523834 |
| Acc. | CX523834 |
| Internal Acc. | s13dNF05E11AT087_440066 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Hordeum vulgare E-value=5e-13; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-13; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=7e-12; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-11; |
| Length | 605 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GTTGTTTACCAACATTACTAACTTTATCCACACACACACACACTCTTTATAATTTTTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829498 |
| Trichome-related Gene from Literature | N/A |