Detail of EST/Unigene CX523876 |
Acc. | CX523876 |
Internal Acc. | s13dNF08A10AT069_447096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Delta(8)-fatty-acid desaturase OS=Borago officinalis E-value=4e-43; Delta(8)-fatty-acid desaturase OS=Helianthus annuus E-value=5e-43; Delta(8)-fatty-acid desaturase OS=Lachancea kluyveri (strain ATCC 58438 / CBS 3082 / CCRC 21498 / NBRC 1685 / JCM 7257 / NCYC 543 / NRRL Y-12651) E-value=5e-14; Delta(8)-fatty-acid desaturase OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=7e-13; Delta(8)-fatty-acid desaturase OS=Kluyveromyces lactis E-value=2e-12; |
Length | 538 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | AGAATATGCAAATATAACCTGAAATTTTTTGTTCAGATGTAGGAACACATAAAAAGTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819228 |
Trichome-related Gene from Literature | N/A |