Detail of EST/Unigene CX524023 |
Acc. | CX524023 |
Internal Acc. | s13dNF12G03AT020_447390 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=2e-20; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-20; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-20; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=1e-19; |
Length | 441 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CATTATTAAATATTAATCAATGGCTTCTATGCAAATCCTTTGGTCATGTAATCAAGTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |