Detail of EST/Unigene CX524043 |
Acc. | CX524043 |
Internal Acc. | s13dNF03A02AT005_447430 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=2e-36; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=4e-36; Lichenase OS=Nicotiana plumbaginifolia E-value=8e-31; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=9e-29; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=1e-28; |
Length | 482 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GGTCACTGCATATGAATCTCTATATAAATATGTGACTTGCAAAAATAAGTTTAGGACTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |