Detail of EST/Unigene CX524114 |
Acc. | CX524114 |
Internal Acc. | s13dNF06A12AT097_447572 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L33, chloroplastic OS=Cicer arietinum E-value=4e-23; 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=5e-23; 30S ribosomal protein S18, chloroplastic OS=Aethionema cordifolium E-value=6e-23; 30S ribosomal protein S18, chloroplastic OS=Pisum sativum E-value=8e-23; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=1e-22; |
Length | 618 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TAACGAATTAAAACTAACAAAAGGTAACAAAGATAAAATACGAGCTTGTTTTATAGCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |