| Detail of EST/Unigene CX524114 |
| Acc. | CX524114 |
| Internal Acc. | s13dNF06A12AT097_447572 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L33, chloroplastic OS=Cicer arietinum E-value=4e-23; 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=5e-23; 30S ribosomal protein S18, chloroplastic OS=Aethionema cordifolium E-value=6e-23; 30S ribosomal protein S18, chloroplastic OS=Pisum sativum E-value=8e-23; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=1e-22; |
| Length | 618 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | TAACGAATTAAAACTAACAAAAGGTAACAAAGATAAAATACGAGCTTGTTTTATAGCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |