Detail of EST/Unigene CX524291 |
Acc. | CX524291 |
Internal Acc. | s13dNF14B03AT025_447926 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-22; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-13; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-12; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=8e-12; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-11; |
Length | 536 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | AACAATTGATGCCACATTTCACTACTCAATTCTTGAACACTCAAAAAATACAATGGCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824403 |
Trichome-related Gene from Literature | N/A |