| Detail of EST/Unigene CX524306 |
| Acc. | CX524306 |
| Internal Acc. | s13dNF14C07AT052_447956 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-ureidopropionase OS=Dictyostelium discoideum E-value=2e-18; Beta-ureidopropionase OS=Pongo abelii E-value=1e-16; Beta-ureidopropionase OS=Homo sapiens E-value=1e-16; Beta-ureidopropionase OS=Rattus norvegicus E-value=5e-16; Beta-ureidopropionase OS=Mus musculus E-value=1e-15; |
| Length | 561 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | CTCAAAACGGAGATGGACAAGTCCGAAAATAGAGCAGAGAATGAACAACTCAAGCTCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
| EC | 3.5.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836558 |
| Trichome-related Gene from Literature | N/A |