| Detail of EST/Unigene CX524317 |
| Acc. | CX524317 |
| Internal Acc. | s13dNF14D06AT048_447978 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=7e-58; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=2e-45; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=2e-42; Cytochrome P450 750A1 OS=Pinus taeda E-value=5e-30; Cytochrome P450 71A3 (Fragment) OS=Solanum melongena E-value=2e-29; |
| Length | 582 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | CACGTGTTACCCATAATCAACAAAAAAATGACTACTTTCTATCTCTCACTCATCATCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816851 |
| Trichome-related Gene from Literature | N/A |