| Detail of EST/Unigene CX524475 |
| Acc. | CX524475 |
| Internal Acc. | s13dNF17C12AT098_448294 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycerol-3-phosphate acyltransferase, chloroplastic OS=Pisum sativum E-value=2e-23; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Phaseolus vulgaris E-value=4e-20; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Carthamus tinctorius E-value=3e-17; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=3e-16; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Cucumis sativus E-value=8e-15; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GAACGTTTGAATAATTTGATAATGAAAAGGTTCTAATATTAACAATTATACATCTATAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840112 |
| Trichome-related Gene from Literature | N/A |