Detail of EST/Unigene CX524502 |
Acc. | CX524502 |
Internal Acc. | s13dNF17G01AT004_448348 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal OS=Raphanus sativus E-value=2e-36; Malate synthase, glyoxysomal OS=Ricinus communis E-value=4e-36; Malate synthase, glyoxysomal OS=Gossypium hirsutum E-value=2e-35; Malate synthase, glyoxysomal OS=Brassica napus E-value=3e-35; Malate synthase, glyoxysomal OS=Zea mays E-value=8e-30; |
Length | 258 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTTTCTCCAAGCTGGGAGAATCTTATGAAAGGTCAAGTGAACTTGAAGGATGCTGTGGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831690 |
Trichome-related Gene from Literature | N/A |