Detail of EST/Unigene CX524637 |
Acc. | CX524637 |
Internal Acc. | s13dNF09D06AT058_477908 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase OS=Eimeria tenella E-value=1e-42; Pyruvate kinase, cytosolic isozyme OS=Glycine max E-value=1e-41; Pyruvate kinase OS=Agaricus bisporus E-value=2e-40; Pyruvate kinase, cytosolic isozyme OS=Solanum tuberosum E-value=3e-40; Pyruvate kinase OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=7e-40; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | AATTCAGCTACATTGACCGGGTCATTGTTCACTTTGCATGCCTCTCAAATTCACATTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824465 |
Trichome-related Gene from Literature | N/A |